frequently asked questions on
    color
name
organism
sequence
output format
codon usage tables

 new in gcua 2.0
 codon usage frequency vs. relative adaptiveness

The codon quality of coding sequences can be depicted in two different ways. The simplest way of depiction is to plot the codon usage frequency that can be found in common codon usage tables. A more elaborate way to depict the codon quality is to convert the codon usage frequency into relative adaptiveness values. In contrast to the codon usage frequency the relative adaptiveness takes into account the number of codons which code for the respective amino acid.
The basic principle for deriving relative adaptivness values out of codon usage frequency values is the following: For each amino acid the codon with the highest frequency value is set to 100% relative adaptiveness. All other codons for the same aminoacid are scaled accordingly. The codon usage table for Escherichia coli at Kazusa lists the following values for Glycine and Glutamate codons:
    AmAcid  Codon      Number    /1000      Fraction   

    Gly     GGG     17628.00     10.99      0.15      
    Gly     GGA     12696.00      7.92      0.11    
    Gly     GGT     39862.00     24.85      0.34    
    Gly     GGC     47212.00     29.44      0.40 

    Glu     GAG     28529.00     17.79      0.31       
    Glu     GAA     63484.00     39.58      0.69     
The frequency of each codon is listed in the 5th column named "Fraction". Comparing the fraction values for the best Glutamate codon GAA (0.69) with the best Glycine codon GGC (0.40) shows clearly that codon frequency values for one aminoacid can not be compared to those of other aminoacids even within the same codon usage table. The relative adaptiveness values can be deduced from the 5th column:
    AmAcid  Codon      Number    /1000      Fraction   Rel.Adapt.
 
    Gly     GGG     17628.00     10.99      0.15        38
    Gly     GGA     12696.00      7.92      0.11        28
    Gly     GGT     39862.00     24.85      0.34        85
    Gly     GGC     47212.00     29.44      0.40       100

    Glu     GAG     28529.00     17.79      0.31        45
    Glu     GAA     63484.00     39.58      0.69       100
The best codon (e.g. GAA for Glu) is set to 100. All others values (e.g. GAG for Glu) are calculated using the rule of proportion (0.31 * (100/0.69) ).

The codon quality of the following sequence strech is analysed by plotting codon usage frequencies (left) and relative adaptiveness values (right).
    G__G__G__G__E__E__D__D__V__V__V__V__ 
    GGGGGAGGTGGCGAGGAAGATGACGTGGTAGTTGTC 
  codon usage frequency plot   relative adaptiveness plot
        

A more detailed description can be found in:
    Sharp PM, Li WH.
    The codon Adaptation Index - a measure of directional synonymous codon usage bias,
    and its potential applications.
    Nucleic Acids Res. 1987 Feb 11;15(3):1281-95.
    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=search&term=3547335


home top of page