![]() |
![]() |
|||||||||||||||
|
||||||||||||||||
| new in gcua 2.0 | ||||||||||||||||
| codon usage frequency vs. relative adaptiveness |
The codon quality of coding sequences can be depicted in two different ways. The simplest way of depiction is to plot the codon usage frequency that can be found in common codon usage tables. A more elaborate way to depict the codon quality is to convert the codon usage frequency into relative adaptiveness values. In contrast to the codon usage frequency the relative adaptiveness takes into account the number of codons which code for the respective amino acid. The basic principle for deriving relative adaptivness values out of codon usage frequency values is the following: For each amino acid the codon with the highest frequency value is set to 100% relative adaptiveness. All other codons for the same aminoacid are scaled accordingly. The codon usage table for Escherichia coli at Kazusa lists the following values for Glycine and Glutamate codons: AmAcid Codon Number /1000 Fraction Gly GGG 17628.00 10.99 0.15 Gly GGA 12696.00 7.92 0.11 Gly GGT 39862.00 24.85 0.34 Gly GGC 47212.00 29.44 0.40 Glu GAG 28529.00 17.79 0.31 Glu GAA 63484.00 39.58 0.69The frequency of each codon is listed in the 5th column named "Fraction". Comparing the fraction values for the best Glutamate codon GAA (0.69) with the best Glycine codon GGC (0.40) shows clearly that codon frequency values for one aminoacid can not be compared to those of other aminoacids even within the same codon usage table. The relative adaptiveness values can be deduced from the 5th column: AmAcid Codon Number /1000 Fraction Rel.Adapt. Gly GGG 17628.00 10.99 0.15 38 Gly GGA 12696.00 7.92 0.11 28 Gly GGT 39862.00 24.85 0.34 85 Gly GGC 47212.00 29.44 0.40 100 Glu GAG 28529.00 17.79 0.31 45 Glu GAA 63484.00 39.58 0.69 100The best codon (e.g. GAA for Glu) is set to 100. All others values (e.g. GAG for Glu) are calculated using the rule of proportion (0.31 * (100/0.69) ). The codon quality of the following sequence strech is analysed by plotting codon usage frequencies (left) and relative adaptiveness values (right). G__G__G__G__E__E__D__D__V__V__V__V__ GGGGGAGGTGGCGAGGAAGATGACGTGGTAGTTGTC |
|||||||||||||||
| codon usage frequency plot | relative adaptiveness plot | |||||||||||||||
![]() |
![]() |
|||||||||||||||
|
A more detailed description can be found in: Sharp PM, Li WH. The codon Adaptation Index - a measure of directional synonymous codon usage bias, and its potential applications. Nucleic Acids Res. 1987 Feb 11;15(3):1281-95. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=search&term=3547335 |
||||||||||||||||
| ||||||||||||||||